leetcode_187
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]Solutions
hash map
straight forward with hash map.
class Solution {
public:
vector<string> findRepeatedDnaSequences(string s) {
if (s.size() < 10) return vector<string>();
unordered_map<string, int> m;
vector<string> res;
for (int i = 0; i < s.size() - 9; i++) {
string substr = s.substr(i, 10);
m[substr]++;
if (m[substr] == 2) res.push_back(substr);
}
return res;
}
};hash map with bit representation
Since there are only
4possible characters in string,20(2 bit per char) bits is the smallest number of bits that can represent a unique10-charsubstring.A 32 bits
integeris enough.When sliding the string, bits representation of the next substring can be quickly calculated by
shiftingthe integer of the current substring.To faciliate the integer-subtring conversion, use
3 bitsrepresentation(char & 7) instead.A = 0b1000001, B = 0b000010, C = 0b1000011, D = 0b1000100
Or replace the int value type to bool.
rolling hash
Last updated
Was this helpful?